Etiologic Risk Group (see link below): risk group level 3 (human and animal pathogen) according to American Biological Safety Association (ABSA)
*/Disease Information (sort of like the Intro to your Mini Research Write up): Mycobacterium tuberculosis (Mtb) is a bacterium that causes Tuberculosis (TB), a pulmonary disease that usually attacks the lungs and can be fatal. Mtb is a gram-negative bacterium that has waxy cell walls that unable gram staining. Lipid-phosphatases protein-tyrosine phosphatase A (PtpA) is one of Mtb’s phosphatases that contribute to its pathogenicity by interfering with the signaling transduction pathway of the host. PtpA blocks phagosome-lysosome fusion and inhibits V-ATPase interaction with the mycobacterial phagosome, which turns off important cellular processes and allows it to survive within the host. Some of TB’s symptoms including fever, chills, chest pain, lost of appetite, and long lasting cough. At this point there are two kinds of tests used to detect Mtb bacteria: TB skin test (TST) and TB blood tests. The treatment for TB could involve several drugs for 6-9 months with the diagnostic methods including tuberculin skin test, acid-fast stain, and chest radiographs.
Complex of proteins?: one of three phosphatases (PtpA, PtpB, and SapM) that contribute to Mycobacterium tuberculosis pathogenicity
catalyse the removal of a phosphate group attached to a tyrosine residue
protein tyrosine phosphate + H2O = protein tyrosine + phosphate
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
- in Macaca fascicularis - PTP-1B antagonizes insulin signaling and is a potential therapeutic target for insulin resistance associated with obesity and type 2 diabetes
- in Homo sapiens - the PTPB1 inhibitor JTT-551 improves glucose metabolism by enhancement of insulin signalling and can be useful in the treatment of type 2 diabetes mellitus
- in Mus musculus - inhibition of the regulatory interaction in TCPTP is a desirable strategy for TCPTP activation and attenuation of oncogenic receptor tyrosine kinase signalling http://www.brenda-enzymes.org/enzyme.php?ecno=3.1.3.48&Suchword=&organism%5B%5D=&show_tm=0
-- -or link (or citation) to paper that contains assay information -- links to assay reagents (substrates) pages.
--- List cost and quantity of substrate reagents, supplier, and catalog #
Tyrosine Phosphatase Assay System (V2471A)
20ml Molybdate Dye Solution (V253A)
200μl Molybdate Dye Additive (V254A)
1ml Phosphate Standard, 1mM (V250A)
1mg Tyr Phosphopeptide-1, END(pY)INASL (V256A)
1mg Tyr Phosphopeptide-2, DADE(pY)LIPQQG (V257A)
1 96-Well Plate (1/2 area, flat bottom) (V252A)
4 Spin Columns, Reservoirs and Adaptors (V249A)
40ml Sephadex ® G-25 (V255A)
25ml Phosphate-Free Water (V654A)
The above quantities are for one Tyrosine Phosphatase assay system, which has a size enough for 96 reactions. The total price is $425.00. The system is supplied by Promega. Sigma Aldrich has discontinued this product.
Structure (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 1U2Q (mptpB), (1U2P) (mptp A)
-- For Homology Model option:
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB
Figure 2. BLASTP of Mycobacterium tuberculosis Low Molecular Weight Protein Tyrosine Phosphatase (MPtpA) with PDB: 1U2Q
---- Query Coverage: 100%
---- Max % Identities: 100%
---- % Positives: 100%
---- Chain used for homology: Chain A of Low Molecular Weight Protein-Tyrosine-Phosphatase
Current Inhibitors:
Expression Information (has it been expressed in bacterial cells):
Expressed in E. Coli cells.
Purification Method:
Primary: Nickel Affinity Chromatography- done because in the primers there is a 6 Histidine tag in the sequence
Image of protein (PyMol with features delineated and shown separately):
No PyMol image available.
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'): 1 msdplhvtfv ctgnicrspm aekmfaqqlr hrglgdavrv tsagtgnwhv gscaderaag 61 vlrahgyptd hraaqvgteh laadllvald rnharllrql gveaarvrml rsfdprsgth 121 aldvedpyyg dhsdfeevfa viesalpglh dwvderlarn gps
*length of your protein in Amino Acids 163
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website 17892.0 kDa
Molar Extinction coefficient of your protein at 280 nm wavelength: 15595
*CDS Gene Sequence (paste as text only): atgtcggacccgctgcacgtgaccttcgtgtgcaccggcaacatctgccgctcgccgatg gccgagaagatgttcgcccagcagctgcgccaccgcggcctgggcgacgccgtgcgcgtg acctcggccggcaccggcaactggcacgtgggctcgtgcgccgacgagcgcgccgccggc gtgctgcgcgcccacggctacccgaccgaccaccgcgccgcccaggtgggcaccgagcac ctggccgccgacctgctggtggccctggaccgcaaccacgcccgcctgctgcgccagctg ggcgtggaggccgcccgcgtgcgcatgctgcgctcgttcgacccgcgctcgggcacccac gccctggacgtggaggacccgtactacggcgaccactcggacttcgaggaggtgttcgcc gtgatcgagtcggccctgccgggcctgcacgactgggtggacgagcgcctggcccgcaac ggcccgtcg
*GC% Content for gene: 74.43%
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only):
1 ATGTCTGACCCGCTCCACGTTACCTTCGTTTGCACCGGTAACATCTGCCGTTCTCCGATG
61 GCGGAAAAAATGTTCGCGCAGCAACTGCGTCACCGTGGTCTGGGTGATGCGGTTCGTGTT
121 ACCTCTGCGGGTACCGGCAACTGGCACGTTGGTTCTTGCGCGGACGAACGTGCGGCTGGT
181 GTTCTGCGTGCGCATGGTTACCCGACCGACCACCGTGCAGCGCAGGTTGGTACCGAACAC
241 CTGGCTGCGGACCTGCTGGTTGCCCTGGACCGTAACCACGCCCGTCTGCTCCGTCAGCTG
301 GGTGTTGAAGCAGCCCGTGTTCGTATGCTGCGTTCTTTCGACCCGCGTTCTGGTACCCAC
361 GCGCTGGACGTTGAAGACCCGTACTACGGCGACCACTCTGACTTCGAGGAAGTTTTCGCG
421 GTTATCGAATCTGCGCTCCCGGGTCTGCACGACTGGGTTGACGAGCGTCTGGCGCGTAAC
481 GGTCCGTCTTAA
*GC% Content for gene (codon optimized): 60.56%
Do Not Need this info for Spring (but still copy these lines to your Target page for now) Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers): (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to. https://docs.google.com/file/d/0B4O2KqKh2q_-bmRPa3hFUVl4eTg/edit
Primer design results for 'tail' primers (this is just 2 sequences):
**
Forward: TACTTCCAATCCATGTCTGACCCGCTGCACGTTAC
Reverse Complemented Reverse: TATCCACCTTTACTGTTAAGACGGACCGTTACGCG
*Target (protein/gene name): Secreted Phosphatase/mptpA
*NCBI Gene # or RefSeq#: ptpA
*Protein ID (NP or XP #) or Wolbachia#: NP_216750.1
*Organism (including strain): Mycobacterium tuberculosis H37Rv (strain: H37Rv)
Etiologic Risk Group (see link below): risk group level 3 (human and animal pathogen) according to American Biological Safety Association (ABSA)
*/Disease Information (sort of like the Intro to your Mini Research Write up):
Mycobacterium tuberculosis (Mtb) is a bacterium that causes Tuberculosis (TB), a pulmonary disease that usually attacks the lungs and can be fatal. Mtb is a gram-negative bacterium that has waxy cell walls that unable gram staining. Lipid-phosphatases protein-tyrosine phosphatase A (PtpA) is one of Mtb’s phosphatases that contribute to its pathogenicity by interfering with the signaling transduction pathway of the host. PtpA blocks phagosome-lysosome fusion and inhibits V-ATPase interaction with the mycobacterial phagosome, which turns off important cellular processes and allows it to survive within the host. Some of TB’s symptoms including fever, chills, chest pain, lost of appetite, and long lasting cough. At this point there are two kinds of tests used to detect Mtb bacteria: TB skin test (TST) and TB blood tests. The treatment for TB could involve several drugs for 6-9 months with the diagnostic methods including tuberculin skin test, acid-fast stain, and chest radiographs.
Link to TDR Targets page (if present): http://tdrtargets.org/targets/view?gene_id=6952
Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.)
http://www.ncbi.nlm.nih.gov/gene/887373
http://www.absa.org/riskgroups/bacteriasearch.php?genus=Mycobacterium
(Chloride and glycerol in the active site) http://www.pdb.org/pdb/explore/explore.do?structureId=1U2Q
(Chloride in the active site ) http://www.pdb.org/pdb/explore.do?structureId=1U2P
http://www.brenda-enzymes.org/enzyme.php?ecno=3.1.3.48&Suchword=&organism%5B%5D=Mycobacterium+tuberculosis&show_tm=0
Essentiality of this protein:
Mptpa - virulence factor (so essentiality is not applicable)
Is it a monomer or multimer as biological unit? (make prediction at http://www.ebi.ac.uk/msd-srv/prot_int/pistart.html): monomer
Complex of proteins?: one of three phosphatases (PtpA, PtpB, and SapM) that contribute to Mycobacterium tuberculosis pathogenicity
catalyse the removal of a phosphate group attached to a tyrosine residue
protein tyrosine phosphate + H2O = protein tyrosine + phosphate
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
- in Macaca fascicularis - PTP-1B antagonizes insulin signaling and is a potential therapeutic target for insulin resistance associated with obesity and type 2 diabetes
- in Homo sapiens - the PTPB1 inhibitor JTT-551 improves glucose metabolism by enhancement of insulin signalling and can be useful in the treatment of type 2 diabetes mellitus
- in Mus musculus - inhibition of the regulatory interaction in TCPTP is a desirable strategy for TCPTP activation and attenuation of oncogenic receptor tyrosine kinase signalling
http://www.brenda-enzymes.org/enzyme.php?ecno=3.1.3.48&Suchword=&organism%5B%5D=&show_tm=0
*EC#: 3.1.3.48
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/enzyme.php?ecno=3.1.3.48
-- Show screenshot of BRENDA enzyme mechanism schematic
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): colorimetric assay
-- link to Sigma (or other company) page for assay (see Sigma links below)
https://www.promega.com/~/media/files/resources/protocols/technical%20bulletins/0/tyrosine%20phosphatase%20assay%20system%20protocol.pdf
-- -or link (or citation) to paper that contains assay information
-- links to assay reagents (substrates) pages.
--- List cost and quantity of substrate reagents, supplier, and catalog #
Tyrosine Phosphatase Assay System (V2471A)
- 20ml Molybdate Dye Solution (V253A)
- 200μl Molybdate Dye Additive (V254A)
- 1ml Phosphate Standard, 1mM (V250A)
- 1mg Tyr Phosphopeptide-1, END(pY)INASL (V256A)
- 1mg Tyr Phosphopeptide-2, DADE(pY)LIPQQG (V257A)
- 1 96-Well Plate (1/2 area, flat bottom) (V252A)
- 4 Spin Columns, Reservoirs and Adaptors (V249A)
- 40ml Sephadex ® G-25 (V255A)
- 25ml Phosphate-Free Water (V654A)
The above quantities are for one Tyrosine Phosphatase assay system, which has a size enough for 96 reactions. The total price is $425.00. The system is supplied by Promega. Sigma Aldrich has discontinued this product.Structure (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 1U2Q (mptpB), (1U2P) (mptp A)
-- For Homology Model option:
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB
---- Query Coverage: 100%
---- Max % Identities: 100%
---- % Positives: 100%
---- Chain used for homology: Chain A of Low Molecular Weight Protein-Tyrosine-Phosphatase
Current Inhibitors:
Expression Information (has it been expressed in bacterial cells):
Expressed in E. Coli cells.
Purification Method:
Primary: Nickel Affinity Chromatography- done because in the primers there is a 6 Histidine tag in the sequence
Image of protein (PyMol with features delineated and shown separately):
No PyMol image available.
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
1 msdplhvtfv ctgnicrspm aekmfaqqlr hrglgdavrv tsagtgnwhv gscaderaag
61 vlrahgyptd hraaqvgteh laadllvald rnharllrql gveaarvrml rsfdprsgth
121 aldvedpyyg dhsdfeevfa viesalpglh dwvderlarn gps
*length of your protein in Amino Acids 163
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website 17892.0 kDa
Molar Extinction coefficient of your protein at 280 nm wavelength: 15595
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
*CDS Gene Sequence (paste as text only):
atgtcggacccgctgcacgtgaccttcgtgtgcaccggcaacatctgccgctcgccgatg gccgagaagatgttcgcccagcagctgcgccaccgcggcctgggcgacgccgtgcgcgtg acctcggccggcaccggcaactggcacgtgggctcgtgcgccgacgagcgcgccgccggc gtgctgcgcgcccacggctacccgaccgaccaccgcgccgcccaggtgggcaccgagcac ctggccgccgacctgctggtggccctggaccgcaaccacgcccgcctgctgcgccagctg ggcgtggaggccgcccgcgtgcgcatgctgcgctcgttcgacccgcgctcgggcacccac gccctggacgtggaggacccgtactacggcgaccactcggacttcgaggaggtgttcgcc gtgatcgagtcggccctgccgggcctgcacgactgggtggacgagcgcctggcccgcaac ggcccgtcg
*GC% Content for gene: 74.43%
*CDS Gene Sequence (codon optimized) - copy from output of Primer Design Protocol (paste as text only):
1 ATGTCTGACCCGCTCCACGTTACCTTCGTTTGCACCGGTAACATCTGCCGTTCTCCGATG
61 GCGGAAAAAATGTTCGCGCAGCAACTGCGTCACCGTGGTCTGGGTGATGCGGTTCGTGTT
121 ACCTCTGCGGGTACCGGCAACTGGCACGTTGGTTCTTGCGCGGACGAACGTGCGGCTGGT
181 GTTCTGCGTGCGCATGGTTACCCGACCGACCACCGTGCAGCGCAGGTTGGTACCGAACAC
241 CTGGCTGCGGACCTGCTGGTTGCCCTGGACCGTAACCACGCCCGTCTGCTCCGTCAGCTG
301 GGTGTTGAAGCAGCCCGTGTTCGTATGCTGCGTTCTTTCGACCCGCGTTCTGGTACCCAC
361 GCGCTGGACGTTGAAGACCCGTACTACGGCGACCACTCTGACTTCGAGGAAGTTTTCGCG
421 GTTATCGAATCTGCGCTCCCGGGTCTGCACGACTGGGTTGACGAGCGTCTGGCGCGTAAC
481 GGTCCGTCTTAA
*GC% Content for gene (codon optimized): 60.56%
Do Not Need this info for Spring (but still copy these lines to your Target page for now)
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
https://docs.google.com/file/d/0B4O2KqKh2q_-bmRPa3hFUVl4eTg/edit
Primer design results for 'tail' primers (this is just 2 sequences):
**
Forward: TACTTCCAATCCATGTCTGACCCGCTGCACGTTAC
Reverse Complemented Reverse: TATCCACCTTTACTGTTAAGACGGACCGTTACGCG